Contents

valdirunars/bigintcompress

An algorithm designed for compressing large collections of elements each having only a few possible values. E.g types representable by an `enum`.

The Algorithm

public func encode() -> Data? {
    var number: CompressionNumber = 0

    for element in self {
        number = number * Self.maxUniqueComponentCount + Self.compressionNumberValue(for: element)
    }

    let string = number.hexString

    let mutableData = NSMutableData()

    var i = 0
    while i < (string.count - 1) {
        if let byte = string.getHexByte(startIndex: i, endIndex: i+2) {
            mutableData.append(Data(repeating: byte, count: 1))
        }
        i += 2
    }
    if string.count % 2 == 1,
        let byte = string.getHexByte(startIndex: string.count-1, endIndex: string.count) {

        mutableData.append(Data(repeating: byte, count: 1))
    }

    let finalData = NSMutableData()

    var count = self.count
    let countData = Data(bytes: &count,
                         count: sizeOfInt)

    finalData.append(countData)
    finalData.append(mutableData as Data)
    return finalData as Data
}

How to Use

Swift Package Manager

.package(url: "https://github.com/valdirunars/BigIntCompress.git", from: "1.0.0"),

Making your collection Compressable

First we must find a big integer type and make it conform to BigIntCompress' BigIntType there are many sufficient swift libraries out there. I usually use BigInt

extension BigInt: BigIntType {

    public var hexString: String {
        return String(self, radix: 16)
    }

    public init?(hexString: String) {
        self.init(hexString, radix: 16)
    }

    public init<T>(_ value: T) where T : Numeric {
        self.init(value)
    }
}

Great! Now we are ready to be Compressable. Lets say that we are working with strings where the possible values for each character are A, C, G & T, like in the case of a DNA's nucleotide.

extension String: Compressable {
    public typealias CompressionNumber = BigInt

    public static var possibleComponents: [Element] {
        return [ "A", "C", "G", "T" ]
    }

    public static func single(_ element: Element) -> String {
        return "\(element)"
    }
}

Now String has two new properties. A static variable bic for decoding and an instance variable with an identical name for encoding.

Encoding and decoding

let expected = """
CCAAGGATTTCCAAGGATTTTTCTCCACTGTTCTCCACTGTTCTCCACTGACAACCCTGGCCACGTATTCTCCACTGGCCACGTAACAACCCTGGCCACGTACCAAGGATTTGGACGGCTCCCCAAGGATTTGGACGGCTCCGCCACGTAGCCACGTATTCTCCACTGACAACCCTGACAACCCTGGCCACGTAGGACGGCTCCACAACCCTGCCAAGGATTTTTCTCCACTGGCCACGTATTCTCCACTGGGACGGCTCCGGACGGCTCCCCAAGGATTTGCCACGTATTCTCCACTGGGACGGCTCCGCCACGTAGGACGGCTCCGGACGGCTCCCCAAGGATTTTTCTCCACTGGGACGGCTCCTTCTCCACTGCCAAGGATTTCCAAGGATTTGCCACGTACCAAGGATTTGGACGGCTCCGCCACGTAGCCACGTACCAAGGATTTCCAAGGATTTGGACGGCTCCTTCTCCACTGTTCTCCACTGCCAAGGATTTTTCTCCACTGGGACGGCTCCACAACCCTGGGACGGCTCCACAACCCTGTTCTCCACTGTTCTCCACTGTTCTCCACTGCCAAGGATTTGGACGGCTCCCCAAGGATTTTTCTCCACTGTTCTCCACTGGGACGGCTCCGCCACGTAGGACGGCTCCACAACCCTGTTCTCCACTGGCCACGTAGCCACGTAACAACCCTGGCCACGTAACAACCCTGCCAAGGATTTCCAAGGATTTCCAAGGATTTACAACCCTGGCCACGTAGGACGGCTCCGCCACGTATTCTCCACTGGCCACGTAACAACCCTGGCCACGTAACAACCCTGGCCACGTAGCCACGTAGCCACGTATTCTCCACTGGGACGGCTCCCCAAGGATTTGCCACGTAGGACGGCTCCTTCTCCACTGGGACGGCTCCGCCACGTAACAACCCTGTTCTCCACTGGCCACGTACCAAGGATTTCCAAGGATTTGGACGGCTCCCCAAGG
"""

let compressed = expected.bic.encode()
let back = try! String.bic.decode(compressed!)!

XCTAssert(back == expected)

Performance

let asciiData: Data! = expected.data(using: .ascii)
XCTAssert(compressed.count * 3 < asciiData.count)

Disadvantages

The algorithm is lossy in the sense that it focuses primarily on a collection's object and thus looses metadata of those collections. BigIntCompress could be implemented to support this appending metadata to the compressed data, in fact it is on my TODO list.

But for now, it is only feasable for compressing "raw" data formats

Package Metadata

Repository: valdirunars/bigintcompress

Default branch: master

README: README.md